أخي أختي الزائر(ة) أنت غير مسجلـ(ة) يمكنك مشاهدة المواضيع لكن لا يمكنك المشاركة فيها ... ندعوكم للإنضمام إلينا بالضغط هنـا

إعلانات المنتدى

::موقع نور الهدى::

:: موقع الشيخ أبي سعيد  ::

:: التعليم نت ::

:: موقع الإكليل ::

:: منتدى الحماية الالكترونية الجزائري ::

:: منتدى موقع الاستضافة المحمية الجزائرية::

إعلانات داخلية

رسالة خاصة

آخر 10 مشاركات 9 نصائح للتخلص من إجهاد العين (الكاتـب : صدام - مشاركات : 0 - المشاهدات : 47 - الوقت: 01:46 AM - التاريخ: 08-01-2015)           »          التعليم يبدأ من البيت : دليل الآباء لتعليم الأبناء من الروضة حتى التعليم الأساسي (الكاتـب : صدام - مشاركات : 0 - المشاهدات : 37 - الوقت: 01:43 AM - التاريخ: 08-01-2015)           »          لماذا أوقف الوليد بن طلال ثروته لأعمال الخير مثل بل جيتس؟ (الكاتـب : صدام - مشاركات : 0 - المشاهدات : 45 - الوقت: 01:38 AM - التاريخ: 08-01-2015)           »          رأس المال في القرن الحادي والعشرين (الكاتـب : صدام - مشاركات : 0 - المشاهدات : 43 - الوقت: 01:35 AM - التاريخ: 08-01-2015)           »          برنامج مميز يعمل علي إكتشاف جميع مشاكل نظام التشغيل ويندوز وإصلاحها بشكل تلقائي (الكاتـب : عبدالله الصيدناوي - مشاركات : 0 - المشاهدات : 44 - الوقت: 06:57 PM - التاريخ: 07-31-2015)           »          " حامل المسك " برنامج لتحفيظ جزء عم للأطفال مسموع و مجود (الكاتـب : yassinovic90 - مشاركات : 0 - المشاهدات : 56 - الوقت: 06:09 PM - التاريخ: 07-31-2015)           »          عندما تكره؛ إكره السلوك، (الكاتـب : abou khaled - آخر مشاركة : amiina - مشاركات : 1 - المشاهدات : 114 - الوقت: 04:45 PM - التاريخ: 07-31-2015)           »          خطوات عملية..ونصائح غالية (الكاتـب : abou khaled - آخر مشاركة : amiina - مشاركات : 1 - المشاهدات : 81 - الوقت: 04:43 PM - التاريخ: 07-31-2015)           »          قصة الخليفة الحكيم (الكاتـب : fares95 - آخر مشاركة : amiina - مشاركات : 2 - المشاهدات : 91 - الوقت: 04:42 PM - التاريخ: 07-31-2015)           »          قصة حقيقية مؤثرة جداا (الكاتـب : abou khaled - آخر مشاركة : amiina - مشاركات : 1 - المشاهدات : 96 - الوقت: 04:41 PM - التاريخ: 07-31-2015)

العودة   منتديات الإكليل إبداع و تميز في التزام > إكليل التربية والتعليم > قسم الباكالوريا العام > منتدى المواد العلمية

منتدى المواد العلمية علوم الطبيعـة و الحيـاة ، العلـوم الفيزيـائيـة ، الريـاضيـات

ღ ღ ღ ღ www.aliklil.com ღ ღ ღ ღ


دراسة الخبر الوراثي

منتدى المواد العلمية

إضافة رد
Share أدوات الموضوع انواع عرض الموضوع
قديم 09-21-2010, 06:17 PM   #2



الصورة الرمزية -Mina-

الملف الشخصي

-Mina- غير متواجد حالياً

افتراضي تموضع الخبر الوراثي

تموضع الخبر الوراثي

تقديم :
عند ملاحظة التوائم الحقيقيين في الصوريتين التاليتين :

نقره لعرض الصورة في صفحة مستقلة
نقره لعرض الصورة في صفحة مستقلة

يتبين أنهما يتشابهان بشكل كبير و لا يمكن أن يكونا إلا من نفس الجنس، و من المعلوم أنهما ينتجان من نفس البيضة أي من نفس الخلية، إذن فتشابههما راجع إلى ترجمة لنفس الخبر الوراثي المتواجد في الخلية الأولى التي أنتجتهما .
الكشف عن تموضع الخبر الوراثي :
/1 تجارب القطع والتطعيم النووي عند طحلب Acetabularia

source des animations avec l'aimable autorisation de Jean-Claude LE HIR
طحلب Acetabularia هو طحلب أحادي الخلية يتكون من ثلاثة أجزاء: وبر جذري و ساق و قبعة .

و يوجد في عدة أنواع منها : انظر الوثيقة
نقره لعرض الصورة في صفحة مستقلة

لنأخذ نوعين من هذه الأنواع (الوثيقة 1) و نجري تجارب القطع و الزرع النووي الممثلة في الوثيقة 2 .
نقره لعرض الصورة في صفحة مستقلة

يتبين من خلال هذه التجارب أن النواة ضرورية لنمو و حياة خلية acetabularia، و هي مسئولة عن نقل الصفات الوراثية ( مثل شكل القبعة أو طول الساق) عند هذا الطحلب.

2/ تجارب عند حيوان أولي:
الأميبة حيوان أولي أحادي الخلية يعيش في الاوساط الرطبة الغنية بالمواد العضوية، نجري تجارب القطع و التطعيم النووي الممثلة في الوثائق التالية:

يتبين من خلال هذه التجارب أن النواة ضرورية لنمو و حياة خلية الأميبة .
3/تجارب عند حيوان ثديي:
تجربة الاستنساخ:
نقره لعرض الصورة في صفحة مستقلة

نلاحظ أن العجلة المولودة أخذت صفات البقرة التي أخذت منها النواة بما فيها جنسها .
4 / خلاصة:
نستخلص من خلال كل هذه التجارب أن النواة هي التي تحدد صفات الكائن الحي، و بالتالي فالخبر الوراثي يتموضع في النواة.

آخر مواضيعي 0 وصفات عالمية للزنجبيل.. الصديق الذي يجب أن لا يفارقنا أبداً
0 لكل مترشح حر..فالنجتمع في هذه الصفحة
0 معيدة للبكالوريا تطلب مساعدة
0 هل نجحت اعطني رقمك..شرط يبدا ب 105
0 "الحياة خادعة"..خاطرة شعرية من اخراجي

:: \\ إعلانات // ::

::=\=:: مواضيع جديدة لم يتم الرد عليها.. نرجوا مشاركتك فيها ::=/=::

نقره لعرض الصورة في صفحة مستقلة

vouloir = pouvoir

نقره لعرض الصورة في صفحة مستقلةللبكالوريا قاهرة ان شاء اللهنقره لعرض الصورة في صفحة مستقلة


رد مع اقتباس
قديم 09-21-2010, 06:30 PM   #3



الصورة الرمزية -Mina-

الملف الشخصي

-Mina- غير متواجد حالياً

Post نقل الخبر الوراثي

استعملت في هذه التجارب بكتيريات تسمى المكورات الرئويةPneumocoques التي توجد في شكلين: بكتيريا S Smooth(ذات محفظة) و أخرى Rough R (بدون محفظة).
نقره لعرض الصورة في صفحة مستقلة

انظر الوثيقةعلى شكل animations flash
يمثل الجدول التالي نتائج هذه التجارب:
الظروف التجريبية
ملاحظة على مستوى الدم
حقن الفأر بمكورات S حية
موت الفأر
مكورات S حية
المكورات الرئوية S مميتة ( حادة)
حقن الفأر بمكورات R حية
يبقى حيا
مكورات R حية
المكورات الرئوية R غير مميتة (غير حادة)
حقن الفأر بمكورات S ميتة(محفظة مهدمة)
يبقى حيا
مكورات S ميتة(مهدمة المحفظة)
المحفظة هي المسئولة عن القدرة الممرضة
حقن الفأر بمكورات R حية+ومكورات S ميتة
موت الفأر
مكورات S حية+مكورات R حية
S الميتة حولت R الحية إلى S حية عن طريق مادة نقلتها إليها (سماها Griffith بالعلة المحولة)

Avery, Mac Leod et Mac Carthy-1944- تجارب
نقره لعرض الصورة في صفحة مستقلة
من خلال هذه التجارب يتبين أن المادة التي انتقلت من S الميتة إلى R الحية لتحولها إلى S حية (بعد تركيبها للمحفظة) هي عبارة عن جزيئة ADN و التي تعني
Acide Desoxyribo-Nucleique اي حمض نووي ريبوزي ناقص أكسجين.
آلية التحول البكتيري:
نقره لعرض الصورة في صفحة مستقلة
بعد موت المكورات S الحادة (1) يتجزأ ADN إلى أجزاء صغيرة (2) فيدمج جزء من ADNs في ADN المكورات R الحية (3) التي تصبح لها القدرة على تركيب المحفظة المسئولة عن المرض. يعني هذا نقل صفة وراثية جديدة من S إلى R .
تجارب Hershey and chase: على العاتيات(فيروسات تتطفل على البكتيريات)
انظر الوثيقة animation Flash

انطلاقا مما سبق يمكن استخلاص ما يلي:
الخبر الوراثي عبارة عن جزيئة ADN ، يتموضع في النواة و ينتقل عبر الصبغيات خلال الانقسام الخلوي.

ملحوظة: نجد أيضا جزء من ADN على مستوى الميتوكوندري و البلاستيدة الخضراء لكنه يتحكم فقط في بعض خصائص هذه العضيات.
- دراسة الصبغيات:
انظر الروابط
-1 الخريطة الصبغية والصيغة الصبغية:
لإنجاز خريطة صبغية نضع الخلايا في وسط اقتياتي تتكاثر فيه، ثم نوقف الانقسامات في المرحلة الاستوائية عندما تكون الصبغيات أكثر وضوحا بإضافة مادة الكولشيسينو التي تمنع هجرة الصبغيات بتفكيكها لمغزل الانقسام، بعد ذلك نضع الخلايا في وسط ناقص التوتر حيث يدخل الماء للخلايا وتتفرقع فنلتقط الصبغيات ثم نصورها بعد تلوينها ثم نرتبها أزواجا حسب شكلها و قدها، إذن فالخريطة الصبغية تضم مجموع صبغيات الخلية الواحدة.

نقره لعرض الصورة في صفحة مستقلة
تمثل الوثيقة الجانبية الخريطة الصبغية لكل من ذكر و أنثى ذبابة الخل، حيث يتبين أن كل الصبغيات توجد على شكل أزواج و يعبر عن الصيغة الصبغية 2n حيث n عدد الأزواج وبذلك تسمى هذه الخلايا ثنائية الصيغة الصبغية.
عند كل من الجنسين الأزواج من 1 إلى 3 صبغيات متماثلة و تسمى الصبغيات اللاجنسية A أما الزوج الأخير فعند الأنثى يتكون من صبغيين متماثلين XX و عند الذكر مكون من صبغيين متغايرين XY ، إذن X و Y يمكنان من التمييز بين الذكر و الأنثى و يطلق عليهما الصبغيين الجنسيين.
الصيغة الصبغية لذكر ذبابة الخل 2n= 3AA+ XY
الصيغة الصبغية لأنثى ذبابة الخل 2n= 3AA+ XX

عند بعض الكائنات لا ترتب الصبغيات على شكل أزواج لأنها غير متماثلة ، نتكلم عن خلايا أحادية الصيغة الصبغية و يرمز لها بـ n
فطر صورداريابكتيريا
الصيغة الصبغية

-2 التركيب الكيميائي للصبغيات:
بينت تجارب مثل تفاعلFeulgenالذي يلون نوعيا ADN بالأحمر أن الصبغي مكون من ADN متحد مع بروتينات تسمى هيستونات.

دراسة ADN
-1التركيب الكيميائي لـ ADN انظر الملف pps
أثبتت الحلمأة الأنزيمية أن ADN يتكون من:
- حمض فوسفوري H3PO4
- سكر ريبوزي ناقص أكسجين C5H10O4

- قواعد أزوتية: A: أدنين،G: كوانين،C: سيتوزين،T: تيمين.
نقره لعرض الصورة في صفحة مستقلة
-2 البنية الجزيئية:
مكنت أعمال Chargaff(1950) من الحصول على العلاقة التالية:
نقره لعرض الصورة في صفحة مستقلة

من خلال أبحاثهما اقترح العالمان Watson et Crick(1953)
نموذجا لـ ADN على شكل لولب مضاعف.
نقره لعرض الصورة في صفحة مستقلة
و يمثل النيكليوتيد الوحدة الأساسية لـ ADN و يتكون من :
سكر ريبوزي ناقص أكسجين + حمض فسفوري + قاعدة أزوتية A أوT أو C أوG.
وبالتالي هناك 4 نيكليوتيدات مختلفة، و بذلك يسمى ADN بعديد النيكليوتيدات.
- القواعد الأزوتية A وT متكاملتين و مرتبطتين برابطتي هيدروجين.

- القواعد الأزوتية C وG متكاملتين و مرتبطتين بثلاث روابط.
انظر الرابط
نقره لعرض الصورة في صفحة مستقلة
ترتبط النيكليوتيدات المنتمية لنفس السلسلة فيما بينها عن طريق الحمض الفسفوري بواسطة الكربون 5' لسكر الريبوز ناقص أكسجين للنيكليوتيد الأول و الكربون 3' لسكر الريبوز ناقص أكسجين للنيكليوتيد الموالي و هكذا إلى نهاية اللولب و بالتالي تكون هناك نهايتين حرتين
3' و 5'
و من تم نصطلح على التوجيه
3'---> 5'
و بما أن جزيئة ADN لولب مضاعف ، فلكي يكتمل اللولبين يجب أن يكونا متضادا القطبية
3'---> 5'
5'---> 3'
نقول إن لولبي ADN مضادا التوازي

انظر الروابط
علاقة ADN بالصبغيات:
في طور السكون يظهر الصبغين مكون من خييطات متشابكة تسمى الخييطات النووية مكونة من ADN يحيط بجزيئات بروتينية(هيستونات).
خلال المرحلة التمهيدية تتكاثف الخييطات النووية و تنتظم على شكل عصيات تسمى الصبغيات( كل صبغي مكون من صبيغيين) ويصل هذا التكاثف أقصاه خلال المرحلة الاستوائية.
نقره لعرض الصورة في صفحة مستقلة

انظر الوثيقة
آلية تضاعف الـ ADN :
تطور كمية ADNخلال دورة خلوية:
مكنت تقنية من قياس و تتبع تطور كمية ADNالموجودة في النواة عند خلية خلال دورة خلوية ، من الحصول على النتائج الممثلة في الرسم البياني التالي:
نقره لعرض الصورة في صفحة مستقلة

مدة هذه الدورة الخلوية 20 ساعة تشكل مرحلة السكون 19 ساعة و الانقسام الغير مباشر M ساعة واحدة.
خلال مرحلة النمو الأولى G1 من طور السكون نلاحظ استقرار كمية ADN في 7,3 يمكن اعتبارها كمية q . خلال مرحلة التركيب S تتضاعف كمية ADN من q إلى 2q لتستقر هذه الكمية 2q في مرحلة النمو الثانية G2 .
أما خلال الانقسام الغير مباشر M فتمر هذه الكمية من 2q إلى q .
إذن قبل الدخول في الانقسام الغير مباشر تضاعف الخلية كمية ADN لتوزيعها بالتساوي على الخليتين البنتين.
خلال المرحلتين G1 و G2 لا تتغير كمية ADN لكن تعرف هاتين المرحلتين تركيب البروتينات.
كيفية مضاعفة ADN:
تجربة Meselson et Stahl(1958)
انظر الوثيقة
وضع العالمان بكتيريات عادية بكثافة (ADN(1.710 في وسط يحتوي على كلورور الأمونيوم بأزوت ثقيل N15 كمصدر اقتياتي، وبعد تعاقب عدة أجيال أصبحت كثافة

ADN(1.724)، ثم أخذا عينة منه واعتبراها جيلا G0 ووضعاها في وسط زرع لا يحتوي إلا على الأزوت الخفيف N14 وتتبعا تعاقب عدة أجيال G2 ، G1 و G3.

الجيل G1 : كل الأفراد لهم dADN=1.717 (كثافة وسيطة بين ADN الثقيل1.724 و ADNالخفيف 1.710 ) واعتبرا هذا الـ ADN هجينا.
خفيف ADN
ADN هجين
G2 الجيل
خفيف ADN
ADN هجين
G3 الجيل
انظر الروابط
نقره لعرض الصورة في صفحة مستقلة
تجربة Taylor(1958)
حمل التجربةflash
قام بالتجارب التالية:
التجربة الأولى: زرع مجموعة أولى من نبتات الفول في وسط مقيت يحتوي على نيكليوتيد إشعاعي( تيميدين) ثم لاحظ صبغيات بعض خلايا جذور هذه النبتة أثناء أول انقسام غير مباشر خلال المرحلة الاستوائية.الشكل أ
التجربة الثانية: نقل نبتات المجموعة الأولى بعد غسلها إلى وسط مقيت عادي يحتوي على تيميدين غير إشعاعي، ثم لاحظ صبغيات بعض خلايا جذور هذه المجموعة الثانية خلال المرحلة الاستوائية من الانقسام الغير مباشر.الشكل ب
التجربة الثالثة: نقل نبتات المجموعة الثانية بعد غسلها إلى وسط مقيت عادي يحتوي على تيميدين غير إشعاعي، ثم لاحظ صبغيات بعض خلايا جذور هذه المجموعة الثالثة خلال المرحلة الاستوائية من الانقسام الغير مباشر.الشكل ج
نقره لعرض الصورة في صفحة مستقلة

التيميدين المشع نيكليوتيد ذو قاعدة ازوتية تيمين يدخل في تركيب ADN و بالتالي يسهل تتبع تطور هذه الجزيئة.
الشكل أ : يظهر الإشعاع على مستوى كل الصبغيات و ذلك في كل صبيغي.
الشكل ب : يظهر الإشعاع على مستوى كل الصبغيات و ذلك في صبيغي واحد من كل صبغي.
الشكل ج: يظهر الإشعاع على مستوى نصف عدد الصبغيات و ذلك في صبيغي واحد من كل صبغي.
تفسير: حمل التفسيرflash
يفترق لولبا جزيئة ADN الأصلية و يشكل كل لولب قالب يشيد عليه لولب جديد بفعل تكامل القواعد الأزوتية و هكذا تتكون جزيئتين مماثلتين للجزيئة الأصلية و هذا ما يسمى بالنسخ الجزيئي.

أثناء المضاعفة يتم الحفاظ على نصف كل جزيئة أصلية و هذا ما يسمى بالمضاعفة النصف محافظة .
نقره لعرض الصورة في صفحة مستقلة

انظر الروابط
النسخ الجزيئي لـ ADN:

أثناء مضاعفة جزيئة ADN تظهر عيون النسخ الجزيئي و يتم هذا النسخ الجزيئي ببلمرة (تجميع) تدريجية للنكليوتيدات الحرة التي تشكل سلسلة مع احترام تكامل القواعد الأزوتية بالنسبة لتلك المتواجدة في اللولب الناسخ وذلك تحت تأثير أنزيم يدعى ADN بوليمراز المسئول عن استطالة السلسلة في اتجاه
5'---> 3'

انظر الرابط

نقره لعرض الصورة في صفحة مستقلة
نقره لعرض الصورة في صفحة مستقلة
تشير الأسهم إلى عيون النسخ

استطالة متقطعة
استطالة متصلة

يفترق اللولبين المكملين بتكسير الروابط الهيدروجينية بواسطة أنزيم التفريق ثم يعمل أنزيم ADN بوليمراز على تجميع النيكليوتيدات الحرة لاستطالة السلسلة للحصول في النهاية على جزيئتين بنتين متماثلتين مع جزيئة ADN الأصلية. و بما أن ADN بوليمراز يعمل في اتجاه واحد أي يجمع النيكليوتيدات في اتجاه
5'---> 3'

ـ تكون الاستطالة متصلة بالنسبة للولب المركب في اتجاه
5'---> 3'

ـ تكون الاستطالة متقطعة بالنسبة للولب المركب في اتجاه
3'---> 5'
حيث يحتاج النسخ في الحالة الأخيرة في كل مرة ARN ممهد و في النهاية يتدخل ADN بوليمراز لإزالة ARN ممهد و تعويضه بنيكليوتيدات ADN

انظر الروابط

آخر مواضيعي 0 وصفات عالمية للزنجبيل.. الصديق الذي يجب أن لا يفارقنا أبداً
0 لكل مترشح حر..فالنجتمع في هذه الصفحة
0 معيدة للبكالوريا تطلب مساعدة
0 هل نجحت اعطني رقمك..شرط يبدا ب 105
0 "الحياة خادعة"..خاطرة شعرية من اخراجي

:: \\ إعلانات // ::

::=\=:: مواضيع جديدة لم يتم الرد عليها.. نرجوا مشاركتك فيها ::=/=::

نقره لعرض الصورة في صفحة مستقلة

vouloir = pouvoir

نقره لعرض الصورة في صفحة مستقلةللبكالوريا قاهرة ان شاء اللهنقره لعرض الصورة في صفحة مستقلة


رد مع اقتباس
قديم 09-21-2010, 06:35 PM   #4



الصورة الرمزية -Mina-

الملف الشخصي

-Mina- غير متواجد حالياً

Post تعبير الخبر الوراثي

تعبير الخبر الوراثي

من خلال دراسة تجارب GRIFFITH تبين أن نقل ADNs إلى المكورات R اكتسبت هذه الأخيرة صفة المحفظة و من تم فهناك علاقة بين الخبر الوراثي و الصفة.
-1 تعريف الصفة:
الصفة هي ميزة نوعية أو كمية تميز فردا عن باقي أفراد نوعه، وهناك صفات ترى بالعين المجردة(لون الأزهار مثلا)
وأخرى تظهر بواسطة اختبارات خاصة(الفصيلة الدموية مثلا).
-2 دراسة مثال لتغير فجائي في الخبر الوراثي:
ظهور المقاومة للستريبتوميسين عند بكتيرية Escherichia Coli
عند زرع بكتيرية Escherichia Coli في وسط مقيت ملائم(غراء+ كليكوز+ فيتامينات+أحماض أمينية في حرارة 37C).
تتشكل مستعمرات بكتيرية تسمى لمات تنتشر فيما بعد ذلك لتشكل كتلة متواصلة على سطح الوسط(بساط بكتيري). لكن عند زرعها في وسط مقيت أضيف إليه Streptomycine الذي يعتبر مضادا حيويا، فإننا نحصل على بعض اللمات فقط على شكل كتل صغيرة مبعثرة على سطح الوسط.
- يتبين من خلال هاتين التجربتين أن البكتيريات التي ماتت بوجود Streptomycine تعتبر حساسة لهذا المضاد الحيوي و يرمز إليها بـ StrepS أما التي بقيت حية تعتبر مقاومة و يرمز إليها بـ StrepR . ظهور هذه الصفة الجديدة تلقائي و بما أنها انتقلت إلى الأجيال الموالية أثناء تكاثر البكتيريات فهي وراثية أي أن التغيير حدث على مستوى المادة الوراثية ADN نسمي هذا التغيير بالطفرة mutation.
- إذن الطفرة هي تغير وراثي و فجائي في انتقال الصفات الوراثية و هذا التغير يمس المادة الوراثية على جزء من ADN الذي يحمل الخبر الوراثي المتعلق بتلك الصفة.
- جزء الـ ADN الذي يحمل الخبر الوراثي المتعلق بصفة معينة يشكل ما يسمى بالمورثة gene. وكل مورثة توجد بنسخة واحدة على صبغي معين و مكانها يسمى موضع المورثة Locus ، كما يمكنها أن توجد على عدة أشكال تسمى الحليلات alleles فمثلا StrepR و StrepS حليلين لنفس المورثة (العلاقة مع المضاد الحيوي Streptomycine فالحليل StrepS متوحش (الأصل) و الحليل StrepR طافر.
- يمكن أن تكون الطفرة تلقائية أو محدثة بعوامل فيزيائية(أشعة) أو كيميائية(مواد كيميائية) أو بيولوجية(فيروسية) ، و هناك عدة أنواع من الطفرات :
ـ طفرة عن طريق إضافة أو ضياع نيكليوتيد. انظر الرابط
ـ طفرة عن طريق استبدال نيكليوتيد بنيكليوتيد آخر. انظر الرابط

ـ طفرة عن طريق تغير ترتيب النيكليوتيدات...
أمثلة لبعض الطفرات
-3 العلاقة صفة ـ بروتين:
تمثل الأمثلة التالية مقارنة بين الأفراد الطافرة و الأفراد المتوحشة:
المثال الأول: الفرق بين الفئران المتوحشة الرمادية و الفئران الطافرة البيضاء هو أن الأولى تتوفر على صبغة الميلانين(تركبها انطلاقا من التيروزين بوجود أنزيم بروتيني) و الثانية لا تتوفر على صبغة الميلانين(غير قادرة على تركيبها نظرا لعدم توفرها على الأنزيم).
نقره لعرض الصورة في صفحة مستقلة
نقره لعرض الصورة في صفحة مستقلة
صفة اللون عند الفئران مرتبطة إذن بنشاط بروتين(أنزيم) .
المثال الثاني: الخضاب الدموي بروتين يوجد داخل الكريات الحمراء و له دورين ، وظيفي يتجلى في نقل الغازات التنفسية و بنيوي يتجلى في إعطاء الشكل الكروي المقعر للكريات الحمراء.ينتج فقر الدم المنجلي عن تركيب خضاب دموي Hemoglobine غير عادي (تشوه الكريات الحمراء تصبح منجلية الشكل) و يرمز له بـ HbS عوض HbA .

نقره لعرض الصورة في صفحة مستقلة
كريات حمراء منجلية الشكل
نقره لعرض الصورة في صفحة مستقلة

تبين الوثيقة الموالية مقارنة بين جزء من الخضاب HbA و الخضاب HbS
نقره لعرض الصورة في صفحة مستقلة
لا تختلف جزيئة HbS عن HbA إلا باستبدال الحمض الأميني 6 رقم GLU بـ VAL.
إذن فشكل الكريات الحمراء(الصفة) مرتبط بطبيعة الخضاب الدموي(البروتين) .
أي أن هناك علاقة بين الصفة و البروتين. فالصفة تترجم بوجود بروتين بنيوي أو وظيفي .
و سبق أن كشفنا عن وجود علاقة بين الصفة و الخبر الوراثي . فما هي طبيعة العلاقة بين الخبر الوراثي و البروتين؟

للإجابة عن هذا التساؤل نقترح دراسة الخبر الوراثي المسئول عن تركيب الخضاب الدموي.
يمثل الشكلان 1 و2 على التوالي جزء من المورثة HbS و جزء من المورثة HbA.

نقره لعرض الصورة في صفحة مستقلة
الشكل 1

نقره لعرض الصورة في صفحة مستقلة
الشكل 2
ـ مقارنة: هناك تشابه في جميع القواعد الأزوتية باستثناء القاعدة T رقم 17 في ADN المتحكم في تركيب HbA و التي عوضت بالقاعدة A في ADN المتحكم في تركيب HbS ، إذن حدثت طفرة .

- استبدال T بـ A على مستوى المورثة أدى إلى استبدال الحمض الأميني GLU بـ VAL على مستوى البروتين و بالتالي تحول HbA إلى HbS الذي أدى الى تغير شكل الكريات الحمراء(الصفة).
ـ إذن هناك علاقة بين المورثة و البروتين: ترتيب النيكليوتيدات في ADN هو الذي يحدد طبيعة و ترتيب الأحماض الأمينية في البروتين.
-4 العلاقة مورثة - بروتين؟
يتم تركيب البروتينات على مستوى السيتوبلاسم تحت إشراف المورثات(ADN) الموجودة في النواة فكيف تصل الإشارات من النواة إلى السيتوبلاسم لتركيب البروتينات.

تجربة Paul et Goldstein:
نقره لعرض الصورة في صفحة مستقلة
تم وضع أميبة في وسط مشع 1 و بعد أن أصبح الإشعاع في النواة 2 وضعت هذه الأخيرة داخل أميبة عادية منزوعة النواة 3 لوحظ أن الإشعاع انتشر إلى السيتوبلاسم 4 .

هذا يوحي بخروج مواد من النواة إلى السيتوبلاسم.
- إذا أخضعنا الأميبة المطعمة بالنواة لتأثير أنزيمات هاضمة لحمض نووي ARN تتوقف النشاطات الخلوية.
إذن المواد التي تخرج من النواة إلى السيتوبلاسم عبارة عن حمض نووي ريبوزي ARN .
بنية و مكونات ARN:
يتكون ARN من متتالية من النيكليوتيدات و كل نيكليوتيد يتكون من:
- حمض فوسفوري H3PO4

- سكر ريبوزي C5H10O5

- قواعد أزوتية: A: أدنين،G: كوانين،C: سيتوزين و بدلا منT نجد U أوراسيل.
مقارنة ARN و ADN
لولب مضاعفلولب واحدالسكر ريبوز ناقص أكسجينالسكر ريبوزالقواعد الأزوتية ACGTالقواعد الأزوتية ACGUكتلة كبيرةكتلة صغيرة
علاقة ADN بــ ARN:

تظهر الوثيقة التالية رسم تخطيطي لملاحظة مجهرية لجزء من ADN حيث يلاحظ و جود أجزاء من ARN ملتصقة به، مما يدل على وجود علاقة بين ADN و ARN .
نقره لعرض الصورة في صفحة مستقلة

تبين الوثيقة التالية كيفية انتقال الطابع الوراثي من ADN إلى ARN أي النسخ الوراثي Tran******ionحيث ينتقل الخبر الناتج عن نسخ المورثة إلى السيتوبلاسم على شكل رسول يسمىARNm .
نقره لعرض الصورة في صفحة مستقلة
يعمل أنزيم ARN بوليمراز على تفريق لولبي ADN في مقدمة المورثة المراد نسخها، ثم يشرف على إدماج النيكليوتيدات الحرة حسب تكامل القواعد الأزوتية، وعندما يصل إلى نهاية المورثة يتم تحرير ARN بوليمراز و ARNm.
ملحوظة: تنتقل عدة جزيئات الأنزيم من موقع بداية الاستنساخ إلى نهايته و هكذا يتم نسخ عدة جزيئات ARNm في آن واحد.

انظر الروابط
علاقة ARNm و تركيب البروتينات:
نحضر خلاصة بكتيريات تحتوي على كل المكونات السيتوبلاسمية لكن ينعدم فيها ADN و ARN ، بعد ذلك تضاف إليها أحماض أمينية و ARNذائب مستخلص من السيتوبلاسم.

ويمثل المبيان التالي النتائج المحصل:

نقره لعرض الصورة في صفحة مستقلة

يتبين أن بعد كل حقن لـ ARN يرتفع عدد الأحماض الأمينية المدمجة في البروتينات،و بالتالي فان ARN هو المسئول عن دمج الأحماض الأمينية في البروتينات .
تركيب البروتينات:

* تجربة Nirenberg:
نقره لعرض الصورة في صفحة مستقلة

توصل هذا العالم إلى مفهوم الرمز الوراثي أي أن كل ثلاثية نيكليوتيدية ترمز إلى حمض أميني معين و تشكل بذلك وحدة رمزية.
و بما أن عدد النيكليوتيدات هو 4 ، فعدد التوافقات الممكنة للإشارة إلى 20 حمض أميني طبيعي هو 43= 64 و هذا يعني أن عدة وحدات رمزية ترمز لحمض أميني واحد وبعضها لا يشير لأي حمض أميني( نقول أنها بدون معنى) و تكون لائحة الوحدات الرمزية و الأحماض الأمينية المناسبة لها الرمز الوراثي Le code génétique

الرمز الوراثي Le code genetique
نقره لعرض الصورة في صفحة مستقلة
انظر الروابط

* يحتاج تركيب البروتينات بالاضافة الى ARNm و المورثة الى:
* ريبوزومات و هي عضيات سيتوبلاسمية صغيرة يتشكل كل واحد منها من وحدة صغيرة و وحدة كبيرة، وتتكون كل وحدة من ARN ريبوزومي (ARNr) و من بروتينات سيتوبلاسمية.

* ARN ناقل (ARNt) الموجود بالسيتوبلاسم، ويختص بنقل الأحماض الأمينية الحرة حسب طبيعة مضاد الوحدة الرمزية الموجود أسفل ARNt.
* أحماض أمينية و هي 20 حمض أميني طبيعي.
* طاقة لمختلف مراحل التركيب ، مصدرها الاستقلاب الطاقي.
* عوامل منشطة

بعض الأحماض الأمينية
نقره لعرض الصورة في صفحة مستقلة
نقره لعرض الصورة في صفحة مستقلة
نقره لعرض الصورة في صفحة مستقلة
نقره لعرض الصورة في صفحة مستقلة
1 موقع تثبيت الحمض الأميني
2 مضاد الوحدة الرمزية

1 وحدة ريبوزومية كبيرة
2 وحدة ريبوزومية صغيرة


* آلية تركيب البروتينات:
يمكن تلخيص ظاهرة تركيب البروتينات في ثلاثة مراحل أساسية و هي:
* المرحلة الأولى:.البداية انظر الرابط
- تثبيت الوحدة الريبوزومية الصغرى على ARNm الذي تكون وحدته الرمزية الأولى AUG .
- وصول ARNt حاملا معه حمض أميني Met .
- تثبيت الوحدة الريبوزومية الكبرى و بداية عمل الريبوزوم.
* المرحلة الثانية:الاستطالة انظر الرابط
- وصول ARNt آخر حاملا معه حمض أميني مطابق للوحدة الرمزية الموالية .
- تشكل رابطة بيبتيدية بين Met و الحمض الأميني الموالي و انشطار الرابطة بين Met و ARNt الذي يغادر الريبوزوم (وجود طاقة ATP )
- يتحرك الريبوزوم بوحدة رمزية واحدة و هكذا تتضاعف الأحماض الأمينية في السلسلة البيبتيدية.
* المرحلة الثالثة:النهاية انظر الرابط
- عندما يصل الريبوزوم إلى الوحدة الرمزية(UAA أو UAG أو UGA ) وهي بدون معنى أي أنها لا تشير إلى أي حمض أميني يتوقف تركيب البروتين و هي تسمى بذلك وحدات قف .
- تفترق وحدتي الريبوزوم عن بعضهما البعض و عن ARNm و يتم تحرير السلسلة البيبتيدية.
- ينفصل الحمض الأميني Met عن باقي السلسلة البيبتيدية .
ملحوظة: تتم ترجمة جزيئة ARNm عدة مرات من طرف مجموعة من الريبوزومات لكن بتأخير زمني وهذا ما يفسر تركيب عدة جزيئات من نفس البروتين. انظر الرابط

انظر الروابط

من النسخ الوراثي إلى تركيب البروتينات(برنامج للتحميل)fichier.zip
تمثل الوثيقة التالية جزء من الخييط الغير مستنسخ لـ ADN مورثة.
1ـ اعط متتالية الأحماض الأمينية المطابقة للبروتين الذي تتحكم في تركيبه هذه المورثة.
2ـ حدد نتيجة استبدال النيكليوتيد C رقم 10 من اللولب المستنسخ بالنيكليوتيد A.

الخييط المستنسخ لـ adn المكمل للخييط الغير مستنسخ هو: TACGGGACACGGTAGTTCATT

متتالية الأحماض الأمينية المطابقة للبروتين المترجم هي :Met- Pro- Cys-Ala-ILe-Lys
2ـ ستستبدل الثلاثية CGG بـ AGG و من تم ستصبح الثلاثية في ARNm كما يلي UCC التي تترجم إلى حمض أميني Ser عوض Ala

آخر مواضيعي 0 وصفات عالمية للزنجبيل.. الصديق الذي يجب أن لا يفارقنا أبداً
0 لكل مترشح حر..فالنجتمع في هذه الصفحة
0 معيدة للبكالوريا تطلب مساعدة
0 هل نجحت اعطني رقمك..شرط يبدا ب 105
0 "الحياة خادعة"..خاطرة شعرية من اخراجي

:: \\ إعلانات // ::

::=\=:: مواضيع جديدة لم يتم الرد عليها.. نرجوا مشاركتك فيها ::=/=::

نقره لعرض الصورة في صفحة مستقلة

vouloir = pouvoir

نقره لعرض الصورة في صفحة مستقلةللبكالوريا قاهرة ان شاء اللهنقره لعرض الصورة في صفحة مستقلة


رد مع اقتباس
قديم 09-21-2010, 06:42 PM   #5



الصورة الرمزية -Mina-

الملف الشخصي

-Mina- غير متواجد حالياً

Post نقل الخبر الوراثي عبر التوالد الجنسي

نقل الخبر الوراثي عبر التوالد الجنسي

تتميز الكائنات ذات التوالد الجنسي بإنتاج أمشاج قادرة على الالتحام فيما بينها خلال ظاهرة الإخصاب لتعطي بيضة تكون مصدرا لكائن جيد يتوفر على نفس عدد الصبغيات للنوع الذي أنتجه. و يمكن تفسير ثبات عدد الصبغيات من جيل إلى آخر بوقوع اختزال عدد الصبغيات أثناء تكون الأمشاج(عند الكائنات ثنائية الصيغة الصبغية).
1 ـ دراسة الانقسام الاختزالي:
يتميز هذا الانقسام بانقسامين متتاليين :
- انقسام منصف : يختزل عدد الصبغيات إلى النصف و يؤدي إلى تشكل خليتين أحاديتي الصيغة الصبغية n .
- انقسام تعادلي : يبقى خلاله عدد الصبغيات ثابتا يؤدي إلى تشكل 4 خلايا أحادية الصيغة الصبغية n .

-أ مراحل الانقسام الاختزالي:

2ـ الانقسام التعادلي انظر الرابط

1ـ الانقسام المنصف انظر الرابط

التمهيدية II
قصيرة جدا تبتدئ مباشرة بعد النهائية I تبقى الصبغيات منشطرة طوليا ما عدا الجزيء المركزي و يظهر المغزل اللالوني من جديد

نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة

التمهيدية I : اقتران الصبغيات المتماثلة لتشكل أزواجا تسمى الرباعيات ، اختفاء الغشاء النووي و النويات

نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلةالاستوائية II
تتموضع الصبغيات لكل خلية في المستوى الاستوائي مشكلة الصفيحة الاستوائية.


نقره لعرض الصورة في صفحة مستقلة

الاستوائيةI : تتموضع الصبغيات المتماثلة من جهتي خط الاستواء .

نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة

لانفصالية II
انشطار الجزيء المركزي و انفصال صبيغيات الصبغي الواحد و هجرة كل مجموعة نحو أحد أقطاب الخلية.

نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة

الانفصاليةI انفصال الصبغيات المتماثلة و هجرتها نحو القطب الخلوي القريب منها دون انقسام الجزيء المركزي

نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة

النهائية II
تتجمع الصبغيات في كل قطب و يزال تلولبها و يتشكل الغشاء النووي و ينقسم السيتوبلاسم و تعطي كل خلية خليتين بنتين فتكون النتيجة الحصول على 4 خلايا أحادية الصيغة الصبغية n

نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة

النهائية I
يتجمع نصف عدد الصبغيات في كل قطب و يحدث انقسام السيتوبلاسم للحصول على خليتين بنتين أحاديتي الصيغة الصبغية n

نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة

انظر الروابط1154321109876

مقارنةالانقسام الغير مباشر و الانقسام الاختزالي

انظر الروابط

نقره لعرض الصورة في صفحة مستقلة
نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة
الانقسام الاختزالي

الانقسام الغير مباشر
يعطي أربع خلايا

يعطي خليتين
يتكون من انقسامين متتالين

يتكون من انقسام واحديختزل عدد الصبغيات إلى النصفيحافظ على عدد الصبغياتينوع الخبر الوراثييحافظ على الخبر الوراثيكمية adn في الخلايا البنات q/2كمية adn في الخليتين البنتين q
تفترق الصبغيات المتماثلةتبقى الصبغيات المتماثلة مجتمعة

-ب تطور كمية ADN خلال الانقسام الاختزالي:

نقره لعرض الصورة في صفحة مستقلةتمثل الوثيقة التالية تطور كمية ADN النووي بدلالة الزمن خلال تكون الأمشاج الذكرية:
يسبق الانقسام الاختزالي A مرحلة السكون D التي تعرف مضاعفة ADN في طور التركيب S من كمية q إلى 2q .
خلال الانقسام المنصف B تنفصل الصبغيات المتماثلة فتحصل كل خلية على كمية q .
خلال الانقسام التعادلي C تنفصل صبيغيات الصبغي الواحد فتحصل كل خلية على q/2 من كمية ADN .

نقره لعرض الصورة في صفحة مستقلةشكل الصبغيات خلال بعض المراحل :
خلال المرحلة G1
خلال المرحلة S
خلال المرحلة G2
خلال المرحلة الانفصالية I
خلال المرحلة الانفصالية II
نقره لعرض الصورة في صفحة مستقلة
نقره لعرض الصورة في صفحة مستقلة
نقره لعرض الصورة في صفحة مستقلة
نقره لعرض الصورة في صفحة مستقلة
نقره لعرض الصورة في صفحة مستقلة
-2 دور الإنقسام الإختزالي:
أ ـ الاختزال الصبغي: اختزال عدد الصبغيات إلى النصف في الخلايا الجنسية و بالتالي المحافظة على عدد الصبغيات بعد الإخصاب.
ب ـانفصال الصبغيات الجنسية: انفصال زوج الصبغيات الجنسية كباقي الصبغيات، يعطي النتائج التالية:
- عند الأنثى: تتشابه الصبغيات الجنسية XX إذن للأمشاج نفس الصيغة الصبغية : n= (n-1)A + X
( متشابهة الأمشاج)
- عند الذكر: تختلف الصبغيات الجنسية XY إذن تشكل نوعين من الأمشاج n= (n-1)A + X
و n= (n-1)A + Y
(متغاير الأمشاج)
وهذه الخاصية هي التي تحدد جنس المولود بعد الإخصاب.
ج ـ تخليط الصبغيات:

تخليط ضمصبغي: انظر الوثيقة

قد يحدثقبل الطور الانفصاليI(ابتداءا من التمهيدية I ) تبادل قطع بين الصبغيين المتماثلين أثناء تباعدهما،
و تسمى هذه الظاهرة العبورCCrossing-over الذي يلعب دورا مهما في تخليط الحليلات و ينتج عنه تركيب صبغي جديد .

نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلةتمرين:باستعمالك لخلية صيغتها الصبغية 2n=2تحمل زوجين من الحليلاتAaBb ،
أبرز بواسطة رسوم تخطيطية التخليط الضمصبغي، محددا عدد الأمشاج المحصل عليها


انظر الروابط 54321

تخليط بيصبغي: انظر الوثيقة1 ـ الوثيقة2 ـالوثيقة3
خلال الطور الانفصالي I يتم انفصال الصبغيات المتماثلة بشكل مستقل وبالتالي هناك نفس التردد للجمع بين الصبغيات من مختلف الأزواج أي يمكن أن يتكون 2n مشيج حيث n عدد الأزواج.
تمرين:باستعمالك لخلية صيغتها الصبغية 2n=4تحمل زوجين من الحليلاتAaBb،أبرز بواسطة رسوم تخطيطية التخليط البيصبغي، محددا عدد الأمشاج المحصل عليها.


نقره لعرض الصورة في صفحة مستقلة

-3 دور الإخصاب:
ـ يعمل الإخصاب على استرداد الصيغة الصبغية الثنائية نتيجة التحام المشيجين الأنثوي و الذكري و من تم الحفاظ على ثبات عدد الصبغيات عند نفس النوع.
ـ تعميق التخليط الصبغي بفعل الالتحام المستقل بين الأمشاج المختلقة وراثيا مما يساهم في تخليط الحليلات و بالتالي تنوع الأفراد.

آخر مواضيعي 0 وصفات عالمية للزنجبيل.. الصديق الذي يجب أن لا يفارقنا أبداً
0 لكل مترشح حر..فالنجتمع في هذه الصفحة
0 معيدة للبكالوريا تطلب مساعدة
0 هل نجحت اعطني رقمك..شرط يبدا ب 105
0 "الحياة خادعة"..خاطرة شعرية من اخراجي

:: \\ إعلانات // ::

::=\=:: مواضيع جديدة لم يتم الرد عليها.. نرجوا مشاركتك فيها ::=/=::

نقره لعرض الصورة في صفحة مستقلة

vouloir = pouvoir

نقره لعرض الصورة في صفحة مستقلةللبكالوريا قاهرة ان شاء اللهنقره لعرض الصورة في صفحة مستقلة


رد مع اقتباس
قديم 09-21-2010, 06:44 PM   #6



الصورة الرمزية -Mina-

الملف الشخصي

-Mina- غير متواجد حالياً

Post مفهوم دورة النمو و الدورة الصبغية

مفهوم دورة النمو و الدورة الصبغية

دورة النمو: هي مجموع الأطوار التي يمر منها الكائن الحي إلى الجيل الموالي.
الدورة الصبغية: تتميز بتعاقب ظاهرتين هامتين الإخصاب و الانقسام الاختزالي ونميز خلالها بين:
- طور أحادي الصيغة الصبغية haplophase يبتدئ بالانقسام الاختزالي و ينتهي بالإخصاب و يتميز بخلايا تحتوي على n من الصبغيات.
- طور ثنائي الصيغة الصبغية diplophase يبتدئ بالإخصاب و ينتهي بالانقسام الاختزالي و يتميز بخلايا تحتوي على 2n من الصبغيات.
يتغير تموضع هاتين الظاهرتين عند الكائنات الحية، بحيث يختلف امتداد الطورين الأحادي والثنائي الصيغة الصبغية، وحسب أهمية أحد الطورين نميز بين دورة أحادية الصيغة الصبغية و دورة ثنائية الصيغة الصبغية و دورة أحادية ثنائية الصيغة الصبغية.
ـ الأمشاج هي خلايا احادية الصيغة الصبغية قادرة على الاندماج فيما بينها لتعطي بيضة.
ـ قد تكون الأمشاج مختلفة القد حيث تكون الأمشاج الذكرية صغيرة القد و الأنثوية كبيرة القد أو لهما نفس القد و نميز بينهما بالرمز + و - .
ـ الابواغ هي خلايا قادرة على الإنبات أو النمو مباشرة لتعطي الكائن الجديد.
-1 دورةأحاديةالصيغةالصبغية
في هذه الحالة يكون الكائن المشيجي أحادي الصيغة الصبغية و يعطي أمشاج أحادي الصيغة الصبغية ، اندماج الأمشاج يعطي بيضة ثنائية الصيغة الصبغية تتعرض لانقسام اختزالي لتعطي أبواغ أحادي الصيغة الصبغية تنمو لتعطي من جديد الكائن المشيجي. إذن فالطور الثنائي الصيغة الصبغية يقتصر على البيضة فقط.
نقره لعرض الصورة في صفحة مستقلة

مثال : طحالب Chlamydomonas
طحالب Chlamydomonas هي طحالب خضراء وحيدة الخلية ، تنتج خلاياها (الخلايا الانباتية) يعد ثلاثة انقسامات غير مباشرة 8 أمشاج صغيرة القد ثنائية السوط .
يتم الإخصاب بين مشيحين لهما نفس الشكل الخارجي لكن يختلفان من الناحية الفيزيولوجية حيث يرمز للمشجين بعلامتي + و - .

تتعرض البيضة بعد فترة وجيزة للانقسام الاختزالي و تحرر 4 خلايا صغيرة القد تنمو لتعطي خلايا انباتية + أو - .
نقره لعرض الصورة في صفحة مستقلة
في هذه الحالة يكون الكائن المشيجي ثنائي الصيغة الصبغية و يعطي بعد الانقسام الاختزالي أمشاجا أحادية الصيغة الصبغية ، اندماج الأمشاج يعطي بيضة ثنائية الصيغة الصبغية تتعرض لانقسامات غير مباشرة و تنمو لتعطي من جديد الكائن المشيجي. إذن فالطور الأحادي الصيغة الصبغية يقتصر على الأمشاج فقط.
نقره لعرض الصورة في صفحة مستقلة

مثال1 : الفوقس الحويصلي طحلب أسمر يعيش مثبتا بواسطة أظفور على صخور الشواطئ، يظهر على شكل صفيحة منبسطة تطفو على الماء بواسطة عقد مملوءة بغاز تسمى الطافيات. عند فترة النضج التناسلي تظهر على نهايات الجهاز الانباتي للفوقس أورام تناسلية تحتوي على عدة تجاويف تسمى الحوافظ الجنسية: الذكرية منها تنتج الأمشاج الذكرية انطلاقا من المئبريات، و الأنثوية تنتج بييضات انطلاقا من النُِميات. بعد الإخصاب تظهر بيضة تنمو لتعطي فوقس فتي ينمو بدوره ليعطي فوقس بالغ.
نقره لعرض الصورة في صفحة مستقلة

مثال2: ذبابة الخل
نقره لعرض الصورة في صفحة مستقلة

-3 دورةأحاديةثنائيةالصيغةالصبغية.
في هذه الحالة يوجد نوعين من الكائنات(جيلين) يكون الكائن المشيجي أحادي الصيغة الصبغية و يعطي أمشاجا أحادية الصيغة الصبغية ، اندماج الأمشاج يعطي بيضة ثنائية الصيغة الصبغية تتعرض لانقسامات غير مباشرة و تنمو لتعطي كائن بوغي ثنائي الصيغة الصبغية.هذا الأخير يتعرض لانقسام اختزالي ليعطي أبواغ أحادي الصيغة الصبغية تنمو لتعطي من جديد الكائن المشيجي.
نقره لعرض الصورة في صفحة مستقلة
خس البحر طحلب اخضر يعيش في البحر مثبتا على الصخور بواسطة أظفور ويوجد على 3 أشكال يصعب التمييز بينها :
نبات مشيجي أنثوي(n):خلال النضج تأخذ جوانبه لونا قاتما
نبات مشيجي ذكري (n):خلال النضج تأخذ جوانبه لونا اصفرا
نبات بوغي: (2n).
أثناء النضج تتكون في جوانب النبات المشيجي أكياس تحرر أمشاجا أحادية الصيغة الصبغية، ثنائية السوط و مختلفة القد،ذكرية صغيرة و أنثوية كبيرة تلتقي في الماء لتعطي بيضة متحركة ثنائية الصيغة الصبغية، تثبت على دعامة و تنمو لتعطي نباتا بوغيا ثنائي الصيغة الصبغية، يحرر ابواغا أحادية الصيغة الصبغية، نتيجة الانقسام الاختزالي تنبت لتعطي نبات مشيجي ذكري أو أنثوي أحادي الصيغة الصبغية.

نقره لعرض الصورة في صفحة مستقلة
مشيج أنثوي x
مشيج ذكري y
يوغ G
بيضة z
نبات بوغي E
انقسام اختزالي F
اخصاب C
نبتة فتية D
نبات مشيجي أنثوي A
نبات مشيجي ذكري B

آخر مواضيعي 0 وصفات عالمية للزنجبيل.. الصديق الذي يجب أن لا يفارقنا أبداً
0 لكل مترشح حر..فالنجتمع في هذه الصفحة
0 معيدة للبكالوريا تطلب مساعدة
0 هل نجحت اعطني رقمك..شرط يبدا ب 105
0 "الحياة خادعة"..خاطرة شعرية من اخراجي

:: \\ إعلانات // ::

::=\=:: مواضيع جديدة لم يتم الرد عليها.. نرجوا مشاركتك فيها ::=/=::

نقره لعرض الصورة في صفحة مستقلة

vouloir = pouvoir

نقره لعرض الصورة في صفحة مستقلةللبكالوريا قاهرة ان شاء اللهنقره لعرض الصورة في صفحة مستقلة


رد مع اقتباس
قديم 09-21-2010, 06:47 PM   #7



الصورة الرمزية -Mina-

الملف الشخصي

-Mina- غير متواجد حالياً

Post مفهوم الهندسة الوراثية

مفهوم الهندسة الوراثية

I انتقال طبيعي لمورثات بكتيرية إلى الخلية النباتية:
مرض جرب السنخ عبارة عن ورم سرطاني ضخم يظهر على مستوي منطقة التقاء الساق و الجذر عند بعض النباتات(الصورة) و قد بينت ملاحظات وجود بكتيريات تدعى Agrobacterium Tumefaciens

نقره لعرض الصورة في صفحة مستقلة

Courtesy Missouri Botanical Garden

1 ـ بعض المعطيات التجريبية:
استنتاجملاحظاتتجارب بكتيريات Agrobacterium Tumefaciens هي التي تحفز الخلايا النباتية على التكاثر العشوائي
ظهور الورم
تجربة 1 : نعزل من ورم جرب السنخ بكتيريات Agrobacterium Tumefaciens و يتم إدخال هذه البكتيريات في فتحة حديثة أنجزت على نبات سليم
الخلايا النباتية اكتسبت صفة الورمية أي التكاثر العشوائي اي ان البكتيريات أحدثت تغييرا في جينوم الخلايا النباتية
لوحظ أن خلايا النسيج تتكاثر بصورة عشوائية عكس الخلايا العادية. تجربة 2 : نزرع نسيج جرب السنخ لا يحتوي على بكتيريات في وسط زرع ملائم

2 ـ ملاحظات

ـ تحتوي البكتيريات بالإضافة إلى صبغيها على حلقات صغيرة من ADN قادرة على الانتقال من خلية إلى أخرى كما أنها سريعة التضاعف و بطريقة مستقلة عن الصبغي البكتيري،تسمى البلاسميدات Plasmides

3 ـ بنية البلاسميد Ti للبكتيريات A.T
مكنت ظاهرة الانتقال الطبيعي لمورثات A.T للخلايا النباتية من وضع الخريطة الوراثية للبلاسميد Ti
نقره لعرض الصورة في صفحة مستقلة
4 ـ خلاصة:

تستغل البكتيرية A.T التي تعيش في التربة وجود الجروح الناتجة عن انخفاض درجة الحرارة لتحقن لخلايا النباتات الجزء ADN-T عن طريق البلاسميد ، ليندمج مع المادة الوراثية للخلية النباتية(لتغيير الوراثي) فيصبح قادرا على التعبير و يتجسد هذا في:
- تركيب كميات كبيرة من الأوبينات OPINES و هي مركبات ضرورية لنمو و تكاثر A.T .
- تكاثر عشوائي للخلايا النباتية.
انظر الرابط
نقره لعرض الصورة في صفحة مستقلة
II تقنيات نقل مورثات من إلى خلية الى اخرى:

1 ـ تعريف:
تشمل الهندسة الوراثية مجموع التقنيات و المناولات التي تسمح بنقل مورثة من نوع إلى آخر.لتحسين المردودية في عدة مجالات، من أهمها الميدان الصيدلي ـ الطبي و الفلاحي و الصناعي. انظر الرابط

2- مراحل نقل مورثة من خلية إلى بكتيرية معينة: انظر الرابط

نقره لعرض الصورة في صفحة مستقلة

نقره لعرض الصورة في صفحة مستقلة
انظرا الروابط التالية:
ـ بالعربية: الرابط
ـ بالانجليزية:
اولى تجارب الهندسة الوراثية 1973
مراحل تلميم مورثة:
انزيمات الفصل
انتقال البلاسميد
نقل و رصد و تلميم
انتاج الأنسلين

3 ـ طريقة لاستخلاص المورثة المرغوب فيها من الخلية
نقره لعرض الصورة في صفحة مستقلة

4 ـ رصد البكتيريات المعدلة وراثيا
نقره لعرض الصورة في صفحة مستقلة

5 ـ بعض تطبيقات الهندسة الوراثية
بكتيريات تركب:
الأنسلين، عوامل التجلط ، هرمون النمو ، أنزيمات تحلل بعض المواد الملوثة كالنفط ، بروتينات مصنعة لا توجد في الطبيعة ...
انتاج الأنسلين
نقره لعرض الصورة في صفحة مستقلة
يمكن أيضا تعديل كائنات متعددة الخلايا.
عند النباتات :
تدمج المورثة في خلية منسية تزرع لتتكاثر لتعطي نبتة جديدة.
ـ نباتات مقاومة للحشرات.
ـ نباتات مقاومة للمبيدات.
ـ نباتات مقاومة للبرودة.
ـ نباتات ذات نكهات جديدة.
ـ نباتات غنية ببعض المواد كالفيتامينات.
عند الحيوان:
تدمج المورثة في بيضة مخصبة ثم توضع في رحم أنثى لتعطي حيوانا معدلا وراثيا.
ـ حيوانات تنمو بسرعة.
ـ حيوانات قليلة الدسم.
ـ حيوانات ذات قدرة إنتاجية كبيرة ( الحليب ، اللحوم ، البيض ... ).
عند الإنسان:
نقل المورثة العادية إلى الخلايا الأصل للنسيج المصاب بخلل ناتج عن غياب أو طفرة أو عدم عمل المورثة ، ثم إعادة زرع الخلايا المعدلة عند المريض.
6 ـ مخاطر :
6 ـ 1 ـ بالنسبة للبيئة:
تأثير على السلالسل الغذائية:
الذرة المعدلة وراثيا تقضي على الحشرات الضارة (فراشة النارية Pyrale ) لكنها تقضي على الحشرات النافعة ايضا التي تتغدى على اليرقات المتطفلة على الذرة, و يبدو ان المواد السامة المركبة من طرف الذرة تصبح اكثر سمية بعد تعرضها لتغيرات كيميائية بفعل استهلاكها من طرف اليرقات و هذا يدفع الى مراعاة كل السلسلة الغذائية اثناء التعديل الوراثي.

سمية المبيدات:

انتشار النباتات المعدلة وراثيا لمقاومة المبيدات يؤدي الى ارتفاع استعمال هذه الأدوية في الميدان الفلاحي مع ما يصاحبه من ارتفاع التلوث و الامراض المرتبطة باستعمال المبيدات من طرف المزارعين.
6 ـ 2 ـ بالنسبة للصحة:
تأثير على الوظائف الحيوية :
يلاحظ عند الفئران التي تتغدى على البطاطس المعدلة وراثيا خلل في جهاز المناعة و في نمو بعض الاعضاء عكس الفئران التي تتغذى على بطاطس عادية رغم اضافة المادة التي تنتجها النباتات المعدلة وراثيا.

الحساسية عند الانسان :
ارتفاع استهلاك نبات الصوجا المعدل وراثيا صاحبه ارتفاع في معدلات الحساسية من هذا النبات و مشتقاته.

مقاومة المضادات الحيوية:
اغلبية النباتات المعدلة وراثيا تحتوي على مورثة مقاومة لمضاد حيوي معين، عند تحلل هذه النباتات تترك اجزاءا من ADN في التربة الذي يمكن ان ينتقل الى بكتيريات اخرى فتصبح مقاومة لبعض المضادات الحيوية المستعملة كادوية من طرف الانسان.

آخر مواضيعي 0 وصفات عالمية للزنجبيل.. الصديق الذي يجب أن لا يفارقنا أبداً
0 لكل مترشح حر..فالنجتمع في هذه الصفحة
0 معيدة للبكالوريا تطلب مساعدة
0 هل نجحت اعطني رقمك..شرط يبدا ب 105
0 "الحياة خادعة"..خاطرة شعرية من اخراجي

:: \\ إعلانات // ::

::=\=:: مواضيع جديدة لم يتم الرد عليها.. نرجوا مشاركتك فيها ::=/=::

نقره لعرض الصورة في صفحة مستقلة

vouloir = pouvoir

نقره لعرض الصورة في صفحة مستقلةللبكالوريا قاهرة ان شاء اللهنقره لعرض الصورة في صفحة مستقلة


رد مع اقتباس
قديم 09-21-2010, 06:54 PM   #8



الصورة الرمزية -Mina-

الملف الشخصي

-Mina- غير متواجد حالياً

Post القوانين الإحصائية لانتقال الصفات الوراثية عند الكائنات الثنائية الصيغة الصبغية

القوانين الإحصائية لانتقال الصفات الوراثية عند الكائنات الثنائية الصيغة الصبغية

تتميز خلايا الكائنات ثنائية الصيغة الصبغية بوجود الصبغيات على شكل أزواج و بالتالي تكون كل مورثة ممثلة بحليلين(مع استثناءات قليلة ،حالة الأمشاج مثلا n ) إما متشابهين و نقول أنها متشابهة الاقتران ويكون الفرد من سلالة نقية بالنسبة للصفة أو الصفات المدروسة أو مختلفين و نقول في هذه الحالة أنها مختلفة الاقتران ويكون الفرد من سلالة هجينة.
مكنت أعمال MENDEL(1822-1884) و MORGAN(1866-1945) الأول على نبات الجلبان و الثاني على ذبابة الخلdrosophile من معرفة كيفية انتقال الصفات الوراثية عند الكائنات الحية و القوانين المحددة لهذا الانتقال.

/I انتقال زوج واحد من الحليلات:الهجونة الاحادية

-1السيادة المطلقة:
-1-1 انتقال صفة" لون حبوب الذرة":

أنجز تزاوجين بين سلالات من الذرة:
ـ التزاوج الأول: بين سلالتين نقيتين الأولى ذات حبوب سوداء و الثانية ذات حبوب صفراء، كانت النتيجة أن كل حبوب الجيل F1 من نبات الذرة سوداء.
ـ التزاوج الثاني: بين أفراد الجيل F1 فيما بينها ( تزاوج ذاتي) نحصل في الجيل F2 على النتائج التالية:
ـ 4986 حبوب صفراء
ـ 15014 حبوب سوداء
-1 ماذا تستخلص من تحليل نتائج التزاوج الأول حول الحليل المسئول عن اللون الأسود و الحليل المسئول عن اللون الأصفر ؟
-2 اعط التفسير الصبغي لنتائج التزاوج الأول.
-3 احسب النسب المئوية لنتائج التزاوج الثاني.
-4 اعط التفسير الصبغي لنتائج التزاوج الثاني.

نقره لعرض الصورة في صفحة مستقلة
-2-1 انتقال صفة" طول أجنحة ذبابة الخل":

يعطي تزاوج ذكر ذبابة خل ذو أجنحة طويلة مع أنثى ذات أجنحة ضامرة،جيلا F1 يتكون من ذباب له أجنحة طويلة.
-1 ماذا تستخلص من تحليل نتائج هذا التزاوج ؟
2- حدد نتيجة تزاوج أفراد F1 فيما بينهم.

نقره لعرض الصورة في صفحة مستقلة
-3-1ـ التزاوج الراجع و التزاوج الاختباري:

يعطي تزاوج ذكر ذبابة خل ذو أجنحة طويلة من الجيل F1 مع أنثى ذات أجنحة ضامرة جيلا يتكون من:
ـ 50%ذباب له أجنحة طويلة
ـ 50% ذباب له أجنحة ضامرة
-1 ماذا نسمي هذا التزاوج ؟
-2 اعط التفسير الصبغي لهذه النتائج.
-3 حدد إذن طريقة للتعرف على النمط الوراثي لفرد ذو مظهر خارجي سائد.

نقره لعرض الصورة في صفحة مستقلة

-4-1خلاصة:( قوانين مندل)

- القانون الأول: تجانس الهجناء: إذا كان الأبوان من سلالة نقية فان الجيل F1 يكون متجانسا .هناك استثناء لهذا القانون.
- القانون الثاني: نق اوة الأمشاج :كل مشيج لا يحتوي إلا على أحد الحليلين نقول أنه نقي.
-2تساوي السيادة:
-1-2 انتقال صفة" لون أزهار شب الليل":
نزاوج سلالتين نقيتين من أزهار شب الليل: سلالة ذات أزهار حمراء و سلالة ذات أزهار بيضاء، فنحصل في الجيل F1 على نباتات هجينة ذات أزهار وردية.
يعطي تزاوج نباتات الجيل الأول فيما بينها جيلا ثانيا غير متجانس و مكون إحصائيا من :
من نباتات ذات أزهار بيضاء 25%من نباتات ذات أزهار حمراء 25%من نباتات ذات أزهار وردية50%
-1 ماذا تستخلص من تحليل نتائج التزاوج الأول حول الحليل المسئول عن اللون الأبيض و الحليل المسئول عن اللون الأحمر ؟
-2 اعط التفسير الصبغي لنتائج التزاوج الأول.
-3 اعط التفسير الصبغي لنتائج التزاوج الثاني.

نقره لعرض الصورة في صفحة مستقلة

-2-2 انتقال صفة" شكل الفجل":

أنجز مزارع تزاوجا بين فجل طويل الشكلL و فجل كروي الشكلR فحصل على جيلا F1 من فجل بيضوي الشكلO.
-1 ماذا تستخلص من تحليل نتائج هذا التزاوج ؟
-2 حدد النمط الوراثي للآباء و أفراد الجيل F1.
-3 حدد النسب النظرية المتوقعة في حالة تزاوج أفراد F1 فيما بينهم.
حصل المزارع على اثر هذا التزاوج على النتائج التجريبية التالية:
121 فجل طويل الشكل.
243 فجل بيضوي الشكل.
119 فجل كروي الشكل.
-4 قارن النتائج النظرية مع النتائج التجريبية.

نقره لعرض الصورة في صفحة مستقلة

-3المورثة المميتة:
-1-3 انتقال صفة" لون فرو الفئران":
أثناء تربية فئران لها فرو مختلف، تم عزل فئران رمادية و أخرى صفراء، فلوحظ أن الفئران الرمادية لا تعطي اثر التزاوج فيما بينها إلا فئران رمادية، أما الصفراء فتعطي اثر التزاوج فيما بينها فئران صفراء و أخرى رمادية.
أ- حلل هذه المعطيات و استنتج النمط الو راثي للفئران الصفراء و الرمادية التي تم عزلها.
ب- ما هي النسب النظرية المحصل عليها بعد تزاوج الفئران الصفراء فيما بينها ؟
بينت الدراسات الإحصائية أنه ينتج دائما عن تزاوج الفئران الصفراء فيما بينها 2/3 فئران صفراء و1/3 فئران رمادية.
ج- هل هذه النتيجة تتوافق مع ما توصلت إليه في السؤال ب ؟
د- فسر هذه النتائج علما أن ملاحظة أرحام فأرات حوامل وضحت وجود أجنة ميتة.

نقره لعرض الصورة في صفحة مستقلة
-2-3 انتقال صفة" وجود أو غياب العرف عند طائرالكناري":

أراد مربي طيور الكناري الحصول على طيور ذات عرف، فزاوج طائري كناري لهما عرف لكنه حصل في الجيل F1 على 10 طائر ذو عرف و 5 طيور بدون عرف، وظل يحصل على نفس النتائج مهما كرر هذا التزاوج.
-1 هل طيور الكناري ذات العرف متشابهة الاقتران أم مختلفة الاقتران ؟ علل جوابك.
-2 حدد الحليل السائد والمتنحي.
-3 حدد النمط الوراثي لطيور الكناري ذات العرف و طيور الكناري بدون عرف ، مستعملا الرموزH للحليل السائد وh للمتنحي.
-4 إذا علمت أنه لا توجد في الطبيعة طيور كناري ذات عرف تعطي اثر التزاوج فيما بينها طيور ذات عرف فقط، فسر هذه الملاحظة علما أن بعض البيض لا يفقس أبدا.

نقره لعرض الصورة في صفحة مستقلة
-4المورثة المرتبطة بالجنس:
-1-4 انتقال صفة" لون العيون عند ذبابة الخل": الوثيقة

ننجز تزاوجات بين سلالتين من ذبابة الخل تختلفان بصفة واحدة: السلالة المتوحشة ذات عيون حمراء والسلالة الطافرة ذات عيون بيضاء.
- التزاوج الأول: بين إناث ذات عيون حمراء و ذكور ذوي عيون بيضاء، الجيل F1 مكون من أفراد لهم جميعا عيون حمراء.
- التزاوج الثاني: بين سلالتين نقيتين،إناث ذات عيون بيضاء و ذكور ذوي عيون حمراء فحصلنا على جيلF'1 يتكون من:
50 إناث ذات عيون حمراء.%
50 ذكور ذوي عيون بيضاء.%

أ- هل الآباء في التزاوج الأول من سلالة نقية ؟ علل جوابك .
ب- حدد الحليل السائد و الحليل المتنحي.
ج- هل تحقق القانون الأول لمندل خلال التزاوج الثاني ؟ ماذا تفترض لتفسير نتائج التزاوج الثاني ؟
د- اعط التأويل الصبغي للتزاوج الأول و التزاوج الثاني.

نقره لعرض الصورة في صفحة مستقلة
عند عدد من الحيوانات خصوصا الفراشات و دودة القز و بعض الطيور و الأسماك تكون الأنثى متغايرة الأمشاج و نرمز لزوج صبغياتها الجنسية ZW و الذكر متشابه الأمشاج ZZ.
عند الدجاج لا تحمل الأنثى إلا صبغيا جنسيا واحدا ZO بينما الذكر ZZ.
-2-4انتقال صفة" شكل الريش عند الدجاج":
يعطي تزاوج بين سلالتين نقيتن من الدجاج : الذكر ذو ريش غير مخطط و الأنثى ذات ريش مخطط ،جيلا F1 مكون من 66 فرد موزعين كالتالي:
ـ 32 ذكرا لهم ريش مخطط
ـ 34 أنثى ذات ريش غير مخطط
1ـ ماذا تستنتج من خلال تحليلك لنتائج هذا التزاوج؟
2ـ اعط الأنماط الوراثية للآباء.باستعمالك للرمزين B و b للتعبير عن الحليلين :
3ـ حدد النتائج النظرية لتزاوج أفراد F1 فيما بينهم.
نقره لعرض الصورة في صفحة مستقلة

-3-4خلاصة: الوثيقة
في حالة هجونة أحادية عند ثنائيات الصيغة الصبغية
ـ إذا كانت النسب في F2 : 3/4-1/4 نتحدث عن سيادة مطلقة لحليل على أخر.
ـ إذا كانت النسب في F2 : 1/4-2/4-1/4 نتحدث عن تساوي السيادة.
ـ إذا تحولت النسب في F2 من 3/4-1/4 إلى 2/3-1/3 نتحدث عن مورثة مميتة.
ـ نتحدث عن مورثة مرتبطة بالجنس في الحالات التالية:
- إذا لم تتطابق نتائج F1 مع القانون I لمندل رغم تزاوج سلالتين نقيتين.
- إذا أخذ الذكور مظهر الأم و أخذت الإناث مظهر الأب.
- إذا لم تتطابق نتائج تزاوجين متبادلين(عكسيين).
/II انتقال زوجين من الحليلات:الهجونة الثنائية
-1مورثتين مستقلتين:
-1-1 انتقال صفتي" لون حبوب" و"شكل الحبوب" عند الذرة:
نزاوج سلالتين نقيتين من الذرة تختلفان فيما بينهما بصفتين اثنتين, الأولى ذات حبوب سوداء وملساء, والثانية ذات حبوب صفراء ومتجعدة.
تبين أن الجيل الأول يتكون من حبوب كلها ملساء الشكل و سوداء اللون.
يتكون الجيل الثاني من أربعة أصناف من الحبوب:
سوداء و ملساء 9/16صفراء وملساء 3/16سوداء و متجعدة3/16صفراء و متجعدة1/16

أ- حلل النتائج المحصل عليها في الجيل الأول والثاني.
ب- اقترح فرضية تفسر بواسطتها ظهور المظاهر الخارجية الجديدة.
ج- بواسطة جدول التزاوج بين النتائج المحصل عليها في الجيل الثاني
نقره لعرض الصورة في صفحة مستقلة

-2-1 خلاصة:القانون الثالث لماندل: قانون استقلالية أزواج الحليلات عند انتقال صفتين أو أكثر
في حالة الهجونة الثنائية و خلال تشكل الأمشاج يحدث افتراق مستقل لزوجي الحليلات بحيث كل جيل F1 (هجين)ينتج 4 أنواع من الأمشاج بنسب متساوية.(هناك استثناء لهذا القانون).
الوثيقة1 ـ الوثيقة2

-3-1 التزاوج الراجعBack-cross :أو الاختباري Test-cross
أعطى تزاوج نبتة طماطم قزمة ذات ساق ملساء من سلالة نقية مع نبتة طماطم عملاقة ذات ساق خشنة ( هجينة من الجيل الأول)النتائج التالية:
نبتة عملاقة ذات ساق خشنة 118نبتة قزمة ذات ساق ملساء 120نبتة عملاقة ذات ساق ملساء121نبتة قزمة ذات ساق خشنة119
أ- ماذا تستنتج من خلال تحليل هذا التزاوج ؟
ب- فسر نتائج هذا التزاوج مستعملا في ذلك D وd للتعبير عن قامة النبتة وH وh عن شكل الساق .

نقره لعرض الصورة في صفحة مستقلة
-2مورثتين مرتبطتين:
-1-2 انتقال صفتي" لون الجسم" و"شكل الأهذاب" عند ذبابة الخل:
نزاوج سلالتين من ذبابة الخل تختلفان في الصفتين، "شكل الأهذاب" و "لون الجسم".
- سلالة ذات أهذاب ملساء و جسم رمادي.
- سلالة ذات أهذاب معقوفة و جسم أسود.
نحصل في الجيل الأول على %100 من الذبابات ذات جسم رمادي و أهذاب ملساء.
أما في الجيل الثاني فنحصل على %75 ذبابة ذات جسم رمادي و أهذاب ملساء و %25 ذبابة ذات جسم أسود و أهذاب معقوفة.
أ- حلل و فسر النتائج المحصل عليها في الجيل الأول والثاني.
نقره لعرض الصورة في صفحة مستقلة
-2-2 التزاوج الراجعback-cross :أو الاختباريTest-cross
(back-cross) نقوم بتزاوج راجع
بين ذبابة خل أنثى ذات أهذاب ملساء و جسم رمادي ( من الجيل الأول ) مع ذبابة ذكر ثنائية التنحي ( والد متنحي )، نحصل على النتائج التالية :
-484 ذبابة ذات جسم رمادي و أهذاب ملساء.
-461 ذبابة ذات جسم اسود و أهذاب معقوفة.
-30 ذبابة ذات جسم رمادي و أهذاب معقوفة.
-25 ذبابة ذات جسم اسود و أهذاب ملساء.

أ- حدد عدد المظاهر الخارجية المحصل عليها. قارنها مع المظاهر الخارجية للوالدين، و اعط نسبها .
ب- ماذا حدث خلال هذا التزاوج ؟
ننجز تزاوجا آخرا بين ذكر من الجيل الأول و أنثى ثنائية التنحي.
نحصل على %50 ذبابة ذات جسم رمادي و أهذاب ملساء و %50 ذبابة ذات جسم أسود و أهذاب معقوفة.
ج- ماذا تستنتج من خلال تحليلك لنتائج التزاوج الثاني؟

نقره لعرض الصورة في صفحة مستقلة
-3خلاصة: الوثيقة
في حالة هجونة ثنائية عند ثنائيات الصيغة الصبغية مع سيادة مطلقة لحليلين على الآخرين:
* الحالة الأولى: حالة مورثتين مستقلتين انظر الرابط
تكون نتائج F2(F1XF1) كالتالي: 9/16-3/16-3/16-1/16 حيث تظهر الحليلات السائدة عند الأفراد ذوي9/16 .
في حالة تزاوج راجع أو اختباري يكون الخلف مكون من أربع مظاهر خارجية متساوية التردد 25% لكل واحد
* الحالة الثانية: حالة مورثتين مرتبطتين
تكون نتائج F2(F1XF1) مخالفة لـ 9/16-3/16-3/16-1/16
في حالة تزاوج راجع أو اختباري يكون الخلف مكون من أربع مظاهر خارجية مختلفة التردد:
-مظهران أبويان بتردد كبير
-مظهران جديدا التركيب بتردد ضعيف
و يمكن الحصول على مظهرين بدلا من أربعة إذا لم يحدث العبور.
/III الخريطة العاملية:
تمثل الخريطة العاملية Carte factorielle التموضع النسبي للمورثات على الصبغيات.
المسافة بين مورثتين:
لاحظ العالم MORGAN أن نسبة التركيب الجديد الناتجة عن ظاهرة العبور بين مورثتين مرتبطتين تكون دائما ثابتة الشيء الذي دفعه إلى افتراض أن مكان تموضع المورثة فوق الصبغي يكون دائما ثابتا. وهكذا أعطى احد طلابه Alfred Sturtevant العلاقة بين نسبة التركيبات الجديدة و المسافة بين المورثتين بحيث:
1% من التركيبات الجديدة تقابلها 1 وحدة مسافة بين المورثتين سميت وحدة MORGAN اي

أعطى تزاوج ذبابة خل أنثى من F1 ذات أجنحة طويلة longues و عيون حمراء rouges بذكر من سلالة نقية ذو أجنحة قصيرة courtes وعيون أرجوانية pourpres النتائج التالية:
عدد الأفراد
المظهر الخارجي
أفراد بأجنحة طويلة و عيون حمراء
أفراد بأجنحة قصيرة و عيون حمراء
أفراد بأجنحة طويلة و عيون أرجوانية
أفراد بأجنحة قصيرة وعيون أرجوانية
-1 حدد عدد المظاهر الخارجية المحصل عليها و احسب نسبها.
-2ماذا تستنتج فيما يخص تموضع المورثتين المدروستين ؟
يعطي تزاوج آخر بين ذبابة خل أنثى مختلفة الاقتران بأجنحة طويلة و جسم رماديgris بذبابة خل ذكر من سلالة نقية ذات أجنحة قصيرة و جسم أسود noir النتائج التالية:
عدد الأفراد
المظهر الخارجي
أفراد بأجنحة طويلة وجسم رمادي
أفراد بأجنحة قصيرة و جسم رمادي
أفراد بأجنحة طويلة و جسم أسود
أفراد بأجنحة قصيرة و جسم أسود
-3حدد العلاقة بين المورثتين المدروستين ؟
-4أنجز الخرائط العاملية الممكنة.
-5 فسر كيفية الحصول على الخريطة العاملية الملائمة.

آخر مواضيعي 0 وصفات عالمية للزنجبيل.. الصديق الذي يجب أن لا يفارقنا أبداً
0 لكل مترشح حر..فالنجتمع في هذه الصفحة
0 معيدة للبكالوريا تطلب مساعدة
0 هل نجحت اعطني رقمك..شرط يبدا ب 105
0 "الحياة خادعة"..خاطرة شعرية من اخراجي

:: \\ إعلانات // ::

::=\=:: مواضيع جديدة لم يتم الرد عليها.. نرجوا مشاركتك فيها ::=/=::

نقره لعرض الصورة في صفحة مستقلة

vouloir = pouvoir

نقره لعرض الصورة في صفحة مستقلةللبكالوريا قاهرة ان شاء اللهنقره لعرض الصورة في صفحة مستقلة


رد مع اقتباس
قديم 02-06-2013, 07:29 PM   #9

nada alg

عضو فضي

الصورة الرمزية nada alg

الملف الشخصي

nada alg غير متواجد حالياً


بوووووووووووووركت اختي دمت ودام نبض قلمك

آخر مواضيعي 0 نشيد سوف يمضي بنا مركب للوداع
0 انشودة عن الام ...حبها في القلب ذائب
0 موقع رائع
0 محمد المقيط انشودة رائعة
0 مواقع اسلامية للمراة المسلمة

:: \\ إعلانات // ::

::=\=:: مواضيع جديدة لم يتم الرد عليها.. نرجوا مشاركتك فيها ::=/=::

ضحكت فقالوا ألا تحتشم*****بكيت فقالوا ألا تبتســـــم
بسمت فقالوا يرائي بهــا*****عبست فقالوا بدا ما كتــم

صمت فقالوا كليل اللسان*****نطقت فقالوا كثير الكــــلم
حلمت فقالوا صنيع الجبان*****ولو كان مقتدرا لانتقــــــم
بسلت فقالوا لطيش بـــــه*****وما كان مجترئا لو حــكم
يقولون شذ إذا قلــت لا*****وإمعة حين وافقتهــــــــم


رد مع اقتباس
إضافة رد

أدوات الموضوع
انواع عرض الموضوع

تعليمات المشاركة
لا تستطيع إضافة مواضيع جديدة
لا تستطيع الرد على المواضيع
لا تستطيع إرفاق ملفات
لا تستطيع تعديل مشاركاتك

BB code is متاحة
كود [IMG] متاحة
كود HTML معطلة

الانتقال السريع

الساعة الآن 11:12 PM.

إعلانات نصية
منتديات الإكليل إبداع وتميز في إلتزام , منتدى التربية والتعليم ; , قسم خاص بالباكالوريا ; , منتدى الحماية الإلكترونية الجزائري;

المنتدى الإسلامي; موقع الشيخ محمد علي فركوس; , موقع الشيخ أبي سعيد; , منار الجزائر;

Powered by vBulletin® Copyright ©2000 - 2015, Jelsoft Enterprises Ltd. , TranZ By Almuhajir
vEhdaa 1.1 by NLP ©2009

HTML | RSS | Javascript | Archive | SiteMap | External | RSS2 | ROR | RSS1 | XML | PHP | Tags